View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_289 (Length: 276)
Name: NF10145A_low_289
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_289 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 79 - 269
Target Start/End: Original strand, 7366990 - 7367178
Alignment:
| Q |
79 |
tttatagaatcactttacgttttaaaaatcctaaatcacatgcacacgccctcgaccatttcttttcacttattgcatacatcacaaagacattttttat |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| |
|
|
| T |
7366990 |
tttatagaatcactttacgttt-aaaaatcctaaatcacatgcacacgccctcgaccatttcttatcacttattgcatacatcacaa-gacattttttat |
7367087 |
T |
|
| Q |
179 |
gcttcatatcgagcttgtttcttgcaaactcatttctgacacctactattagctttagtaattaattactataagtgtgcttgatattttt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7367088 |
gcttcatatcgagcttgtttcttgcaaactcatttctgacacccactattagctttagtaattaattactataagtgtgcttgatattttt |
7367178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 6 - 79
Target Start/End: Original strand, 7366844 - 7366917
Alignment:
| Q |
6 |
atttcaaaattgattgtgagatgagttttggttaaaaataagctgaaattaaacattaatatatttgaagttgt |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7366844 |
atttcaaaattgattgtgagatgagttttggttaaaaataagctgaaattaaacattaatatatttgaagttgt |
7366917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University