View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_292 (Length: 275)
Name: NF10145A_low_292
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_292 |
 |  |
|
[»] scaffold0615 (1 HSPs) |
 |  |  |
|
[»] scaffold0063 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 88; Significance: 2e-42; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 15 - 127
Target Start/End: Original strand, 22246001 - 22246115
Alignment:
Q |
15 |
gttgcttttggaactagaaacactttaagtttggggttggggtactagagaaagatgaatcactttgtgct--aaaaaaaaggatataagcatgataaaa |
112 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||| ||||||||||| ||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
22246001 |
gttgcttttggaactagcaacactttaagtttggggtaggggtactagacaaagaagaatcactttgtgctcaaaaaaaaaggatataagcatgataaaa |
22246100 |
T |
 |
Q |
113 |
tatggtgatcatttg |
127 |
Q |
|
|
||||||||||||||| |
|
|
T |
22246101 |
tatggtgatcatttg |
22246115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 178 - 275
Target Start/End: Original strand, 22246167 - 22246264
Alignment:
Q |
178 |
gtgatcagtttttcaatcattaaaagttctctctagtccccggtttaaattgtgatatgatgttatggtgcatggtgtattttagatccgtaggttga |
275 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
22246167 |
gtgatcagtttttcattcattaaaagttctctctagtccccggttttaattgtgatatgatgttatggtgcacggtgtattttagatccgtaggttga |
22246264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 178 - 275
Target Start/End: Original strand, 15536941 - 15537039
Alignment:
Q |
178 |
gtgatcagtt-tttcaatcattaaaagttctctctagtccccggtttaaattgtgatatgatgttatggtgcatggtgtattttagatccgtaggttga |
275 |
Q |
|
|
|||||||||| ||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |||||| |||||||||||||| |
|
|
T |
15536941 |
gtgatcagttgtttcattcattaaaagttctctctagtccccgattttaattgtgatatgatgttatggtgcatggtatatttttgatccgtaggttga |
15537039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 178 - 275
Target Start/End: Original strand, 14794256 - 14794354
Alignment:
Q |
178 |
gtgatcagtt-tttcaatcattaaaagttctctctagtccccggtttaaattgtgatatgatgttatggtgcatggtgtattttagatccgtaggttga |
275 |
Q |
|
|
|||||||||| ||||| ||| |||||||| ||||||||||||| ||| |||| |||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
T |
14794256 |
gtgatcagttgtttcattcaataaaagttatctctagtccccgattttaattttgatatgatgttatggtgcatggtatattttagatcagtaggttga |
14794354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 15 - 93
Target Start/End: Original strand, 14794082 - 14794164
Alignment:
Q |
15 |
gttgcttttggaactagaaacactttaagtttggggttggggtactagagaaaga----tgaatcactttgtgctaaaaaaaa |
93 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
14794082 |
gttgcttttggaactagcaacactttaagtttggggtaggggtactagagaaagaaaagagaatcactttgtgctaaaaaaaa |
14794164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 15 - 112
Target Start/End: Original strand, 15536767 - 15536866
Alignment:
Q |
15 |
gttgcttttggaactagaaacactttaagtttggggttggggtactagagaaagatga-----atcactttgtgctaaaaaaaaggatataagcatgata |
109 |
Q |
|
|
|||||||||||||||||||||||| ||| |||||||| |||||||||| |||||| | |||||||||||||||||||| |||||||||||||| |
|
|
T |
15536767 |
gttgcttttggaactagaaacactctaaatttggggtaggggtactagggaaagaaaagagatatcactttgtgctaaaaaaa---atataagcatgata |
15536863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 15 - 116
Target Start/End: Complemental strand, 648981 - 648878
Alignment:
Q |
15 |
gttgcttttggaactagaaacactttaagtttggggttggggtactagagaaaga----tgaatcactttgtgctaaaaaaaaggatataagcatgataa |
110 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
648981 |
gttgcttttggaactagaaacactttaagtttggggtaggggtactagagaaagaaaagagaatcactttgtgctaaaaaaaa--atataagcatgataa |
648884 |
T |
 |
Q |
111 |
aatatg |
116 |
Q |
|
|
|||||| |
|
|
T |
648883 |
aatatg |
648878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 178 - 275
Target Start/End: Complemental strand, 648818 - 648721
Alignment:
Q |
178 |
gtgatcagtttttcaatcattaaaagttctctctagtccccggtttaaattgtgatatgatgttatggtgcatggtgtattttagatccgtaggttga |
275 |
Q |
|
|
||||||| | ||||| ||| |||||||| ||||||||||||||||| || |||||||||||| ||||||||||||| ||||||||||| ||||||||| |
|
|
T |
648818 |
gtgatcattgtttcattcaataaaagttatctctagtccccggttttaagtgtgatatgatgctatggtgcatggtatattttagatcagtaggttga |
648721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 178 - 274
Target Start/End: Complemental strand, 15533836 - 15533739
Alignment:
Q |
178 |
gtgatcagtt-tttcaatcattaaaagttctctctagtccccggtttaaattgtgatatgatgttatggtgcatggtgtattttagatccgtaggttg |
274 |
Q |
|
|
|||||||||| ||||| ||| |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
T |
15533836 |
gtgatcagttgtttcattcaataaaagttatctctagtccccggttttaattgtgatatgatgttatggtgcatggtatattttagatcagtaggttg |
15533739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 15 - 116
Target Start/End: Complemental strand, 15534004 - 15533898
Alignment:
Q |
15 |
gttgcttttggaactagaaacactttaagtttggggttggggtactagagaaaga----tgaatcactttgtgct-aaaaaaaaggatataagcatgata |
109 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |||||||| |||||||||||||| |
|
|
T |
15534004 |
gttgcttttggaactagcaacactttaagtttggggtaggggtactagagaaagaaaagagaatcactttgtgctaaaaaaaaaatatataagcatgata |
15533905 |
T |
 |
Q |
110 |
aaatatg |
116 |
Q |
|
|
||||||| |
|
|
T |
15533904 |
aaatatg |
15533898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 63; Significance: 2e-27; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 15 - 116
Target Start/End: Complemental strand, 17864870 - 17864768
Alignment:
Q |
15 |
gttgcttttggaactagaaacactttaagtttggggttggggtactagagaaaga----tgaatcactttgtgctaaaaaaaaggatataagcatgataa |
110 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
T |
17864870 |
gttgcttttggaactagcaacactttaagtttggggtaggggtactagagaaagaaaagagaatcactttgtgctaaaaaaa---atataagcatgataa |
17864774 |
T |
 |
Q |
111 |
aatatg |
116 |
Q |
|
|
|||||| |
|
|
T |
17864773 |
aatatg |
17864768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 178 - 268
Target Start/End: Complemental strand, 42780742 - 42780651
Alignment:
Q |
178 |
gtgatcagtttttcaa-tcattaaaagttctctctagtccccggtttaaattgtgatatgatgttatggtgcatggtgtattttagatccgt |
268 |
Q |
|
|
|||||||||| ||||| ||||||| ||||||||||||||||||| || |||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
T |
42780742 |
gtgatcagttattcaagtcattaatagttctctctagtccccggattcaattgtgatatggtgttatggtgcgtggtgtattttagatccgt |
42780651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 178 - 275
Target Start/End: Complemental strand, 17864709 - 17864611
Alignment:
Q |
178 |
gtgatcagtt-tttcaatcattaaaagttctctctagtccccggtttaaattgtgatatgatgttatggtgcatggtgtattttagatccgtaggttga |
275 |
Q |
|
|
|||||||||| ||||| ||| ||||| | ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
T |
17864709 |
gtgatcagttgtttcattcaataaaaataatctctagtccccggttttaattgtgatatgatgttatggtgcatggtatattttagatcagtaggttga |
17864611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 15 - 69
Target Start/End: Complemental strand, 42780915 - 42780861
Alignment:
Q |
15 |
gttgcttttggaactagaaacactttaagtttggggttggggtactagagaaaga |
69 |
Q |
|
|
||||||||||||||||| |||| | |||||||||||| ||||||||||||||||| |
|
|
T |
42780915 |
gttgcttttggaactagcaacattctaagtttggggtaggggtactagagaaaga |
42780861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 23 - 65
Target Start/End: Complemental strand, 18972166 - 18972124
Alignment:
Q |
23 |
tggaactagaaacactttaagtttggggttggggtactagaga |
65 |
Q |
|
|
||||||||| |||||| |||||||||||| ||||||||||||| |
|
|
T |
18972166 |
tggaactagcaacactctaagtttggggtaggggtactagaga |
18972124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 59; Significance: 5e-25; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 15 - 116
Target Start/End: Original strand, 13494980 - 13495082
Alignment:
Q |
15 |
gttgcttttggaactagaaacactttaagtttggggttggggtactagagaaaga----tgaatcactttgtgctaaaaaaaaggatataagcatgataa |
110 |
Q |
|
|
||||||| ||||||||| ||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| |
|
|
T |
13494980 |
gttgcttctggaactagcaacactttaagtttggggtaggggtactagagaaagaaaagagaatcactttgtgctaaaaaaa---atataagcatgataa |
13495076 |
T |
 |
Q |
111 |
aatatg |
116 |
Q |
|
|
|||||| |
|
|
T |
13495077 |
aatatg |
13495082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 15 - 68
Target Start/End: Complemental strand, 21912703 - 21912650
Alignment:
Q |
15 |
gttgcttttggaactagaaacactttaagtttggggttggggtactagagaaag |
68 |
Q |
|
|
|||||| |||||||||| |||||| |||||||||||| |||||||||||||||| |
|
|
T |
21912703 |
gttgctcttggaactagcaacactctaagtttggggtaggggtactagagaaag |
21912650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 15 - 51
Target Start/End: Original strand, 1935460 - 1935496
Alignment:
Q |
15 |
gttgcttttggaactagaaacactttaagtttggggt |
51 |
Q |
|
|
||||||||||||||||| |||||| |||||||||||| |
|
|
T |
1935460 |
gttgcttttggaactagcaacactctaagtttggggt |
1935496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0615 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0615
Description:
Target: scaffold0615; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 15 - 114
Target Start/End: Original strand, 3668 - 3769
Alignment:
Q |
15 |
gttgcttttggaactagaaacactttaagtttggggttggggtactagagaaagat----gaatcactttgtgctaaaaaaaaggatataagcatgataa |
110 |
Q |
|
|
||||||||||||||||| |||||||||||| | || ||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
3668 |
gttgcttttggaactagcaacactttaagtctcaagtaggggtactagagaaagaaaagagaatcactttgtgctaaaaaaaa--atataagcatgataa |
3765 |
T |
 |
Q |
111 |
aata |
114 |
Q |
|
|
|||| |
|
|
T |
3766 |
aata |
3769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0063 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: scaffold0063
Description:
Target: scaffold0063; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 178 - 275
Target Start/End: Complemental strand, 8547 - 8450
Alignment:
Q |
178 |
gtgatcagtttttcaatcattaaaagttctctctagtccccggtttaaattgtgatatgatgttatggtgcatggtgtattttagatccgtaggttga |
275 |
Q |
|
|
||||||||| ||||| ||| | |||||||||||||| ||||||||| ||||||||||||| ||| | |||| |||| || ||||||||||||| |||| |
|
|
T |
8547 |
gtgatcagtgtttcattcaatcaaagttctctctagcccccggttttaattgtgatatgaggttttagtgcttggtatagtttagatccgtagtttga |
8450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0063; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 15 - 69
Target Start/End: Complemental strand, 8717 - 8663
Alignment:
Q |
15 |
gttgcttttggaactagaaacactttaagtttggggttggggtactagagaaaga |
69 |
Q |
|
|
||||||||||||||||| ||||||| ||||||||||| ||||| ||||||||||| |
|
|
T |
8717 |
gttgcttttggaactagcaacacttcaagtttggggtaggggttctagagaaaga |
8663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 15 - 93
Target Start/End: Original strand, 36531984 - 36532066
Alignment:
Q |
15 |
gttgcttttggaactagaaacactttaagtttggggttggggtactagagaaaga----tgaatcactttgtgctaaaaaaaa |
93 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||| |||| |||||||||||| |||||||||||||||||||||| |
|
|
T |
36531984 |
gttgcttttggaactagcaacactttaagtttggggtaggggcactagagaaagagaagaaaatcactttgtgctaaaaaaaa |
36532066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 178 - 220
Target Start/End: Complemental strand, 46731760 - 46731717
Alignment:
Q |
178 |
gtgatcagtt-tttcaatcattaaaagttctctctagtccccgg |
220 |
Q |
|
|
|||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
T |
46731760 |
gtgatcagttgtttcattcattaaaagttctctctagtccccgg |
46731717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University