View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_3 (Length: 581)
Name: NF10145A_low_3
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 96; Significance: 8e-47; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 332 - 435
Target Start/End: Complemental strand, 16060253 - 16060150
Alignment:
| Q |
332 |
ctcaaagacttcccccagtggcccttctggaacttgcccaggctgcgcagcctctggttgaggtgcgggctctcctccgggctgttccaagtccctaaag |
431 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16060253 |
ctcaaagacttcccctagtggcccttctggaacttgcccatgctgcgcagcctctggttgaggtgcgggctctcctccgggctgttccaagtccctaaag |
16060154 |
T |
|
| Q |
432 |
atag |
435 |
Q |
| |
|
|||| |
|
|
| T |
16060153 |
atag |
16060150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 95; Significance: 3e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 9 - 134
Target Start/End: Complemental strand, 2625298 - 2625175
Alignment:
| Q |
9 |
atcagggggtcagttttgtggatattcttcgcgcaatgcgagaagttcccggaaaagggagatttggtcccctctctatccaactgggcgagtcggtttg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||| |||||| ||||||||||||||| ||||||||||| |
|
|
| T |
2625298 |
atcagggggtcagttttgtggatattcttcgcgcaatgcaagaagttcccggaaaaggcagattcggtccc--ctctatccaactgggtgagtcggtttg |
2625201 |
T |
|
| Q |
109 |
taagagtctctggccgatattcccac |
134 |
Q |
| |
|
|||||||||||| ||||||||||||| |
|
|
| T |
2625200 |
taagagtctctgtccgatattcccac |
2625175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 64; Significance: 1e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 171 - 282
Target Start/End: Complemental strand, 31772896 - 31772790
Alignment:
| Q |
171 |
gctggttcggttttcaacccagaaagggtctgggtccagctcggccatccgagatataatataacctgacttttgaggttaatcaaagttagaatatcat |
270 |
Q |
| |
|
|||| |||||||||||||| |||||||||| |||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
31772896 |
gctgattcggttttcaacctagaaagggtcggggtccagctcgcccatctgagatataa-----cctgacttttgaggttaatcaaagttataatttcat |
31772802 |
T |
|
| Q |
271 |
ctatggggggct |
282 |
Q |
| |
|
|||||||||||| |
|
|
| T |
31772801 |
ctatggggggct |
31772790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University