View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_306 (Length: 269)
Name: NF10145A_low_306
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_306 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 7 - 138
Target Start/End: Original strand, 52763360 - 52763491
Alignment:
| Q |
7 |
tcgaataatattaaaaaagggtagttggtaatggactcaaaacatttgtatgaacaaatcctttattagttagtattcctcttagagataggtttaagca |
106 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52763360 |
tcgaagaaaattaaaaaagggtagttggtaatggactcaaatcatctgtatgaacaaatcctttattaggtagtattcctcttagagataggtttaagca |
52763459 |
T |
 |
| Q |
107 |
gttgtttgagttggctgaaaatcgttggattt |
138 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |
|
|
| T |
52763460 |
gttgtttgaattggctgaaaatcgttggattt |
52763491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 187 - 264
Target Start/End: Original strand, 52763540 - 52763617
Alignment:
| Q |
187 |
tatgaaggcataaaagtggcggtggaggctgttactttgcatgttgatattgaagaccattgacgatgacaactagat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52763540 |
tatgaaggcataaaagtggcggtggaggctgttactttgcatgttgatattgaagaccattgacgatgacaactagat |
52763617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University