View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_328 (Length: 263)
Name: NF10145A_low_328
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_328 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 5 - 263
Target Start/End: Complemental strand, 12760153 - 12759901
Alignment:
| Q |
5 |
agtttggagttcaataataacacctggactggaccggaccgccggactcttttatcttaacgtggaaaacgcttcttcttataa-cactttaattcttac |
103 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
12760153 |
agttaggacttcaataataacacctggactggaccg-----ccggactcttttatcttaacgtggaaaacgcttcttcttataaacactttaattcttac |
12760059 |
T |
 |
| Q |
104 |
aaattacaaattctttgataaaagttgaagtttatagtcatcattgggctttactgcttgcaaccttactttgaattactttctcttttggttttgtgtg |
203 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12760058 |
aaattacagatcctttgataaaagttgaagtttatagtcatcattgggctttactgtttgcaaccctactttgaattactttctcttttggttttgtgtg |
12759959 |
T |
 |
| Q |
204 |
ggccagggttttgatcagcactgcatgcatgtgtttgatatatgtcgttatgaattatga |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12759958 |
ggccagggttttgatcagcactgcatgcatgtgtttg--atatgtcgttatgaattatga |
12759901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University