View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_336 (Length: 259)
Name: NF10145A_low_336
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_336 |
 | |
|
| [»] chr1 (4 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 17 - 259
Target Start/End: Complemental strand, 33810983 - 33810741
Alignment:
| Q |
17 |
tggtatgtgatttgaagtggttggaggtatagagtaaagggatggctcgagatggtagcgttgtccctgctgacccacaggctcttgtgaagaagaagac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33810983 |
tggtatgtgatttgaagtggttggaggtatagggtaaagggatggctcgagatggtagcgttgtccctgctgacccacaggctcttgtgaagaagaagac |
33810884 |
T |
|
| Q |
117 |
acagtcttctagaagctggattgcttttgatggtactggccaagggtctttgcttgatgtggacaagtatgctatcatgcatagggttcagattaatgca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33810883 |
acagtcttctagaagctggattgcttttgatggtactggccaagggtctttgcttgatgtggacaagtatgctatcatgcatagggttcagattaatgca |
33810784 |
T |
|
| Q |
217 |
cgtgatcttagaatccttgatcccttgctctcttacccctcta |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33810783 |
cgtgatcttagaatccttgatcccttgctctcttacccctcta |
33810741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 17 - 259
Target Start/End: Complemental strand, 33870452 - 33870210
Alignment:
| Q |
17 |
tggtatgtgatttgaagtggttggaggtatagagtaaagggatggctcgagatggtagcgttgtccctgctgacccacaggctcttgtgaagaagaagac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33870452 |
tggtatgtgatttgaagtggttggaggtatagggtaaagggatggctcgagatggtagcgttgtccctgctgacccacaggctcttgtgaagaagaagac |
33870353 |
T |
|
| Q |
117 |
acagtcttctagaagctggattgcttttgatggtactggccaagggtctttgcttgatgtggacaagtatgctatcatgcatagggttcagattaatgca |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33870352 |
acagtcttctagaagctggattgcttttgatggtactggccaagggtctttgcttgatgtggacaagtatgctatcatgcatagggttcagattaatgca |
33870253 |
T |
|
| Q |
217 |
cgtgatcttagaatccttgatcccttgctctcttacccctcta |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33870252 |
cgtgatcttagaatccttgatcccttgctctcttacccctcta |
33870210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 107 - 258
Target Start/End: Complemental strand, 33831068 - 33830917
Alignment:
| Q |
107 |
agaagaagacacagtcttctagaagctggattgcttttgatggtactggccaagggtctttgcttgatgtggacaagtatgctatcatgcatagggttca |
206 |
Q |
| |
|
||||||||||||||||||||| ||| |||||| ||||||| ||| |||||||||| | | ||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
33831068 |
agaagaagacacagtcttctacaagttggattcagtttgatgctacaggccaagggtggattcatgatgtggacaagtatgttatcatgaatagggttca |
33830969 |
T |
|
| Q |
207 |
gattaatgcacgtgatcttagaatccttgatcccttgctctcttacccctct |
258 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
33830968 |
tattgatgcacgtgatcttagaatccttgatcctttgccctcttacccctct |
33830917 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 107 - 258
Target Start/End: Complemental strand, 33893231 - 33893080
Alignment:
| Q |
107 |
agaagaagacacagtcttctagaagctggattgcttttgatggtactggccaagggtctttgcttgatgtggacaagtatgctatcatgcatagggttca |
206 |
Q |
| |
|
||||||||||||||||||||| ||| |||||| ||||||| ||| |||||||||| | | ||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
33893231 |
agaagaagacacagtcttctacaagttggattcagtttgatgctacaggccaagggtggattcatgatgtggacaagtatgttatcatgaatagggttca |
33893132 |
T |
|
| Q |
207 |
gattaatgcacgtgatcttagaatccttgatcccttgctctcttacccctct |
258 |
Q |
| |
|
||| |||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
33893131 |
tattgatgcacgtgatcttagaatccttgatcctttgccctcttacccctct |
33893080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 101 - 256
Target Start/End: Original strand, 24408805 - 24408960
Alignment:
| Q |
101 |
ttgtgaagaagaagacacagtcttctagaagctggattgcttttgatggtactggccaagggtctttgcttgatgtggacaagtatgctatcatgcatag |
200 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||| ||| ||| |||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24408805 |
ttgtgaagaagaagacacagtcttttggaagctggattgctttggatagtaatggccactggtctcaaattgatgtggacaagtatgctatcatgcatag |
24408904 |
T |
|
| Q |
201 |
ggttcagattaatgcacgtgatcttagaatccttgatcccttgctctcttacccct |
256 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24408905 |
ggttcagattaatgcacatgatcttagaatccttgatcccttgctctcttacccct |
24408960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 170 - 258
Target Start/End: Complemental strand, 24410211 - 24410123
Alignment:
| Q |
170 |
ttgatgtggacaagtatgctatcatgcatagggttcagattaatgcacgtgatcttagaatccttgatcccttgctctcttacccctct |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24410211 |
ttgatgtggacaagtatgctatcatgcatagggttcagattaatgcatgtgatcttagaatccttgatcccttgctctcttacccctct |
24410123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 101 - 143
Target Start/End: Complemental strand, 24410676 - 24410634
Alignment:
| Q |
101 |
ttgtgaagaagaagacacagtcttctagaagctggattgcttt |
143 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
24410676 |
ttgtgaagaagaagacacagtcttttggaagctggattgcttt |
24410634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 49 - 80
Target Start/End: Original strand, 24408777 - 24408808
Alignment:
| Q |
49 |
agtaaagggatggctcgagatggtagcgttgt |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24408777 |
agtaaagggatggctcgagatggtagcgttgt |
24408808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University