View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_338 (Length: 259)
Name: NF10145A_low_338
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_338 |
 | |
|
| [»] scaffold1660 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold1660 (Bit Score: 114; Significance: 7e-58; HSPs: 1)
Name: scaffold1660
Description:
Target: scaffold1660; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 5 - 175
Target Start/End: Original strand, 1032 - 1203
Alignment:
| Q |
5 |
agaatgaatgggttacacttacaagtacttgtat-gaatcgaatccaatgataccatggaaatttgccaagagatcaac---aacaacagtagtttaaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| || || |||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1032 |
agaatgaatgggttacacttacaagta--tgaatcgaatcgaatc-aatgataccatggaaatttgccaagagatcaacaacaacaacagtagtttaaaa |
1128 |
T |
|
| Q |
101 |
tggattgttagaaaaattcctacaatctgaaagagggaaaaacagaagtcatgtccacagatcatcatataatga |
175 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
1129 |
tggattgttacaaaaattcatacaatctgaaagagggaaaaacagaaatcatgtccacaaatcatcatataatga |
1203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University