View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_339 (Length: 259)
Name: NF10145A_low_339
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_339 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 181 - 250
Target Start/End: Complemental strand, 276344 - 276275
Alignment:
Q |
181 |
ttgaaaaccattacatatcaattccttactaccatacaatctagtggtaatgtgaaccatgcattcatat |
250 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
276344 |
ttgaaaaccattacatatcaattccttactaccatacaatctagtggtaatgtgaaccatgcattcatat |
276275 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University