View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_344 (Length: 257)
Name: NF10145A_low_344
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_344 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 12 - 257
Target Start/End: Complemental strand, 7431064 - 7430826
Alignment:
| Q |
12 |
tgttgctatatactatgaagcattatcatgatgaagcactaacacagacaccggacatgttgacgccggtaatagtattaaaacatgtaatattgaatgt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7431064 |
tgttgctatatactatgaagcattatcacgatgaagcactaacacagacaccggacatgttgacaccggtaatagtattaaaacatgtaatattgaatgt |
7430965 |
T |
|
| Q |
112 |
aactgtatgtgaagtcttggtggttggtgctatatgggttatatagaacttgattttgttttgattactgtgaaggtgatcgttttgaaattgtgtttgc |
211 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
7430964 |
aactggatgtgaagtcttggtg-------ctatatgggttatatagaacttgattttgttttgaatagtgtgaaggtgatcgttttgaaattgtgtttgc |
7430872 |
T |
|
| Q |
212 |
ttgaatagctagcttacttttgcattagatgaaagattggttttga |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7430871 |
ttgaatagctagcttacttttgcattagatgaaagattggttttga |
7430826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University