View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_350 (Length: 255)
Name: NF10145A_low_350
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_350 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 1675663 - 1675412
Alignment:
| Q |
1 |
tttggagttggcatggacttgtggtttcaaacgagttgatcttcaaatggattccaagggacaataccctcaattcgagaagggcagggagtgatagagg |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
1675663 |
tttggagttggcttggacttgtggtttcaaacgagttgatcttcaaatggattccaagggcaaataccctcaattcaagaagggcagggagggatagagg |
1675564 |
T |
|
| Q |
101 |
ttccaggttgatacaacacattcttcattggttggaaaaggattgggaaatgaaagtgtcatccaaatttaaaatcatgaagctaatttttgtatggatg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1675563 |
ttccaggttgatacaacacattcttcattggttggaaaaggattgggaaatgaaagtgtcatccaaatttaaaatcatgaagctaatttttgtgtggatg |
1675464 |
T |
|
| Q |
201 |
ttttggcacctatgggttgtgaaggtggtagttcagtgataatatatatgag |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1675463 |
ctttggcacctatgggttgtgaaggtggtagttcagtgataatatatatgag |
1675412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University