View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_353 (Length: 253)
Name: NF10145A_low_353
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_353 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 12 - 231
Target Start/End: Complemental strand, 34726037 - 34725818
Alignment:
Q |
12 |
atgaactacctaatgttggatgatttccctgtctggtttatcttatttgagattcttttttcctatactgaagcgtcatttagtacactaccttcgaagg |
111 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34726037 |
atgaactacctaatgttggatgatttccctgtctggtttatcttatttgagattcttttttcctatactgaagcgtcatttagtacactaccttcgaagg |
34725938 |
T |
 |
Q |
112 |
aacttcaaggaagtacgaaggaacttcgaggaagtacataggcccctacaggtacatagtgggagtcgacgaaaagaaaatgttattggtcccttcaatt |
211 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
34725937 |
aacttcaaggaagtacgaaggaacttcgaggaagtacataggcccctacaggtacatagtgggagtcgacaaaaagaaaatgttattggtcccttcaatt |
34725838 |
T |
 |
Q |
212 |
ctttgtcaacttggtttatc |
231 |
Q |
|
|
|||||||||||| ||||||| |
|
|
T |
34725837 |
ctttgtcaacttagtttatc |
34725818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University