View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_354 (Length: 253)
Name: NF10145A_low_354
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_354 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 142 - 241
Target Start/End: Original strand, 39781337 - 39781436
Alignment:
| Q |
142 |
gttccactatattagtcaaccatgtcatcgcactgggttgctctcatgtgacccgatttgaaagactatatggtaattacaaaatctgcacacaggttct |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
39781337 |
gttccactatattagtcaaccatgtcatcgcactgggttgctctcatgtgacccgatttgaaagactatatggtaattacaaaatctgcaaacatgttct |
39781436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 39781203 - 39781271
Alignment:
| Q |
1 |
aaagaaaatttgaaacttaggttggtacttctnnnnnnntttgagtgctaacaaatgtacattgaaata |
69 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39781203 |
aaagaaaatttaaaacttagtttggtacttctaaaaaaacttgagtgctaacaaatgtacattgaaata |
39781271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University