View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_357 (Length: 252)
Name: NF10145A_low_357
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_357 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 8e-76; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 7 - 162
Target Start/End: Complemental strand, 46208678 - 46208523
Alignment:
Q |
7 |
tttggtgttaggtctctgtggtagccactttgatcctcatgcttcgtcttggccgcttcgaacattgcgagatgagaattgacggattgttgttgggtag |
106 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46208678 |
tttggtgttaggtctttgtggtagccactttgatcctcatgcttcgtcttcgccgcttcgaacattgcgagatgagaattgacggattgttgttgggtag |
46208579 |
T |
 |
Q |
107 |
tggatgaagaatggtggatatggtgttgagagcaatcatgttccaattcaaatcca |
162 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
46208578 |
tggatgaagaatggtggatatggtgttgagagcagtcatgttccaattcaaatcca |
46208523 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 7 - 103
Target Start/End: Complemental strand, 48962714 - 48962610
Alignment:
Q |
7 |
tttggtgttaggtctctgtggtagccactttgatcctcatgcttcgt---------cttggccgcttcgaacattgcgagatgagaattgacggattgtt |
97 |
Q |
|
|
||||||||||||||| |||||||||||||||||| | |||||||||| ||| |||||||||| |||||||||||||||||||||||||||| |
|
|
T |
48962714 |
tttggtgttaggtct-tgtggtagccactttgattcccatgcttcgttccattcgtctttgccgcttcgaggattgcgagatgagaattgacggattgtt |
48962616 |
T |
 |
Q |
98 |
gttggg |
103 |
Q |
|
|
|||||| |
|
|
T |
48962615 |
gttggg |
48962610 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 192 - 232
Target Start/End: Complemental strand, 46208493 - 46208453
Alignment:
Q |
192 |
aaattgtgagttacacacatgacattttcatttatttttaa |
232 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
46208493 |
aaattgtgagttacacacatcgcattttcatttatttttaa |
46208453 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 243
Target Start/End: Original strand, 46209389 - 46209418
Alignment:
Q |
214 |
cattttcatttatttttaattcaaaaatta |
243 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
46209389 |
cattttcatttatttttaattcaaaaatta |
46209418 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 53 - 103
Target Start/End: Complemental strand, 17368039 - 17367989
Alignment:
Q |
53 |
tcttggccgcttcgaacattgcgagatgagaattgacggattgttgttggg |
103 |
Q |
|
|
|||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
17368039 |
tcttcgccgcttcgaggattgcgagatgagaattgacggattgttgttggg |
17367989 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University