View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_361 (Length: 251)
Name: NF10145A_low_361
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_361 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 11 - 216
Target Start/End: Original strand, 28249817 - 28250022
Alignment:
| Q |
11 |
tgagatggacatcaacggcgcggtaaagatcatcgtcgattttacgcgcgtgtttaggaataagaacagcgattccgttgaattttgagatgctgagttc |
110 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28249817 |
tgagatagatatcaacggcgcggtaaagatcatcgtcgattttacgcgcgtgtttaggaataagaacagcgattccgttgaattttgagatgctgagttc |
28249916 |
T |
 |
| Q |
111 |
accgtacgcggcgatttcagcgaggtacatatcgacggttttcgccacacgcagcatagggacggagaatgattgtttgagttctcccggtgtgaaaacc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28249917 |
accgtacgcggcgatttcagcgaggtacatgtcgacggttttcgccacacgcagcatagggacggagaatgattgtttgagttctcccggtgtgaaaacc |
28250016 |
T |
 |
| Q |
211 |
gctgtg |
216 |
Q |
| |
|
|||||| |
|
|
| T |
28250017 |
gctgtg |
28250022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University