View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_369 (Length: 251)
Name: NF10145A_low_369
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_369 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 11 - 235
Target Start/End: Complemental strand, 37849291 - 37849067
Alignment:
Q |
11 |
catcaaactgttccaaatagtaagtagtaagttatcgtttccacaaagattattgttcttttctactacgcaattaactaaactaatgaattaaaataat |
110 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
37849291 |
catcaaactgttccaaatagtaagtagtaagttatcgtttccacaaagattattgttgttttctactacgcaattaactaaactaatgaattaaaacaat |
37849192 |
T |
 |
Q |
111 |
aaattgtgaggagtttgcagttttgatttgaatgtgaaacacaagttgtttgattgcaaaataaataaaagagatttggttcagattataagcggcgact |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37849191 |
aaattgtgaggagtttgcagttttgatttgaatgtgaaacacaagttgtttgattgcaaaataaataaaagagatttggttcagattataagcggcgact |
37849092 |
T |
 |
Q |
211 |
aggatttttcaaatcccctctacca |
235 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
37849091 |
aggatttttcaaatcccctctacca |
37849067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University