View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_377 (Length: 250)
Name: NF10145A_low_377
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_377 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 4 - 246
Target Start/End: Complemental strand, 39485694 - 39485446
Alignment:
| Q |
4 |
gagtttcgtgttacccatcaaggtcttattctgactatgcacttgaattaccgtaa--------cataatttgttttaaatattctcttcattactttga |
95 |
Q |
| |
|
||||||| |||||| | |||||||||||||||||||||| | |||||||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
39485694 |
gagtttcatgttactcgtcaaggtcttattctgactatgtagttgaattaccgtaagtccgtaacataatttgtcttaaatattctcttcattactttga |
39485595 |
T |
|
| Q |
96 |
catcctttatgaccaaactcacatgtttcataagtatattactttgatataagacatcaaagaccttcatcaaattaacatgtttggatcgctcaatcct |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39485594 |
catcctttatgaccaaactcacatgtttcataagcatattactttgatataagacatcaaagaccttcatcaaattgacatgtttggatcgctcaatcct |
39485495 |
T |
|
| Q |
196 |
tnnnnnnnnnttatggtgctcactttcttgcgatgttagtttgtttcttct |
246 |
Q |
| |
|
| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39485494 |
t-aaaaaaaattatggtgctcactttcttgcgatgttag-ttgtttcttct |
39485446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University