View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_381 (Length: 250)
Name: NF10145A_low_381
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_381 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 20 - 239
Target Start/End: Original strand, 24301046 - 24301265
Alignment:
Q |
20 |
tcaatttagacatatcatattttatttccaaccctacaacctagtaaaatatctttaactttatgctcattcttgtaccaattttcatttgggcttcgaa |
119 |
Q |
|
|
|||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| |
|
|
T |
24301046 |
tcaacttagacatatcatattttatttccaaccatacaacctagtaaaatatctttaactttatgctcattcttgtaccaattttcacttgggctttgaa |
24301145 |
T |
 |
Q |
120 |
gcccgcagtgtgggttcggatgagcatctgtttagagctattgatgagcttttttcaactcaacgaggaaacttttcttcaacattgatcagagtccact |
219 |
Q |
|
|
|||||||||||||||| |||| ||| |||||| |||| ||| ||||||||| | || |||| ||||||||||||||||||||||||||||||||| |
|
|
T |
24301146 |
gcccgcagtgtgggttatgatgcgcacctgtttggagccatttatgagctttcatacgcttaacggagaaacttttcttcaacattgatcagagtccact |
24301245 |
T |
 |
Q |
220 |
ccaacacttccaacatattt |
239 |
Q |
|
|
|||||||||||||||||||| |
|
|
T |
24301246 |
ccaacacttccaacatattt |
24301265 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University