View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_387 (Length: 250)
Name: NF10145A_low_387
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_387 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 7 - 250
Target Start/End: Original strand, 43258001 - 43258244
Alignment:
| Q |
7 |
tttggagttctgcactcatgagattcctcaagcatttctgtctggaccagaaacaaacctcaggaggttaactgagttggttgtatttatcttgaatcac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43258001 |
tttggagttctgcactcatgagattcctcaagcatttctgtctggaccagaaacaaacctcaggaggttaactgagttggttgtatttatcttgaatcac |
43258100 |
T |
|
| Q |
107 |
atgacttcttcagccgatgctgaattctttgaattgtaagttacaagcctgtgacttaaacttgagcttatagaccagaagtattttattttaattattg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43258101 |
atgacttcttcagccgatgctgaattctttgaattgtaagttacaagcctgtgacttaaacttgagcttatagaccagaagtattttattttaattattg |
43258200 |
T |
|
| Q |
207 |
tttatccatctttgatatattgatattgcttctggagagactga |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43258201 |
tttatccatctttgatatattgatattgcttctggagagactga |
43258244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University