View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_390 (Length: 250)
Name: NF10145A_low_390
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_390 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 45 - 250
Target Start/End: Complemental strand, 49825515 - 49825318
Alignment:
| Q |
45 |
agatttgattgaggcaaacagtcaggtaaattatgatcactttggttatatcnnnnnnnnatattgtgatacgatcgtatttttatgcatgttggtaatt |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||| ||||||||||||||||| ||||| |
|
|
| T |
49825515 |
agatttgattgaggcaaacagtcaggtaaattatgatcactttggttatagcttttt----tattgtgatatgattgtatttttatgcatgttattaatt |
49825420 |
T |
|
| Q |
145 |
tggagtgcgtttcatttgatcagggtaaaccctcaagcgagcgagtatccaaatgaatttgatattgttgttggaaaacaaatgctatttaaggttggaa |
244 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||| ||||| || |||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
49825419 |
tggagtgcgttttatttgatcagggtaaaccctcaag----cgagtatcccaatgagttggatatttttgttggaaaacaaatgctatttaaggttgaaa |
49825324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University