View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_391 (Length: 250)
Name: NF10145A_low_391
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_391 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 44577634 - 44577876
Alignment:
| Q |
1 |
acatcattacaaccatcattacaacaatggtaagtctttggtaaaaaagctatacagtgaaaattgtattcccctgacaaagtatcaccgtcaccaataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44577634 |
acatcattacaaccatcattacaacaatggtaagtctttggtaaaaaagctatacagtgaaaattgtattcccctgacaaagtatcactgtcaccaataa |
44577733 |
T |
|
| Q |
101 |
aactgtaaatgattgctgttttcagatacaaaatgttatgtggaaattgatagtcttgctaaggtgaatgacacacagtttccctcagagaattctgaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44577734 |
aactgtaaatgattgctgttttcagatacaaaatgttatgtggaaattgatagtcttgctaaggtgaatgacacacagtttccctcagagaattctgaat |
44577833 |
T |
|
| Q |
201 |
acgtttcaactgctgcaactggtatatatattattaacaccat |
243 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44577834 |
acgtttcaactgctgcaactggtacatatattattaacaccat |
44577876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 99 - 219
Target Start/End: Original strand, 44579895 - 44580009
Alignment:
| Q |
99 |
aaaactgtaaatgattgctgttttcagatacaaaatgttatgtggaaattgatagtcttgctaaggtgaatgacacacagtttccctcagagaattctga |
198 |
Q |
| |
|
|||||||||||||||| |||||| ||||| |||| ||||||||||||| ||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44579895 |
aaaactgtaaatgatttctgtttgcagatccaaa------tgtggaaattgatggtcttcctaaggtgaatgacacacagtttcccttagagaattctga |
44579988 |
T |
|
| Q |
199 |
atacgtttcaactgctgcaac |
219 |
Q |
| |
|
|||||||||| |||||||||| |
|
|
| T |
44579989 |
atacgtttcagctgctgcaac |
44580009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University