View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_392 (Length: 250)
Name: NF10145A_low_392
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_392 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 99 - 234
Target Start/End: Complemental strand, 2561152 - 2561019
Alignment:
Q |
99 |
catctctaatcatgttgcacccaattgatatatatattcctatgagcattcatatagtagtttacaatcctcatacgaagaagctattgagtgatcatca |
198 |
Q |
|
|
||||||||||||||||||||||||||||||||||| || |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2561152 |
catctctaatcatgttgcacccaattgatatatat--tcatatgtgcattcatatagtagtttacaatcctcatacgaagaagctattgagtgatcatca |
2561055 |
T |
 |
Q |
199 |
tgtttgttcccaggccacatacatctgttgatgtcc |
234 |
Q |
|
|
|||||||||||||||||||||||||||| ||||||| |
|
|
T |
2561054 |
tgtttgttcccaggccacatacatctgtcgatgtcc |
2561019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University