View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_393 (Length: 250)
Name: NF10145A_low_393
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_393 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 40688442 - 40688205
Alignment:
Q |
1 |
attagaggcattcataaaggatctaacatattgaatgatgggagcataaggatgaatgtatataggattattccttacactcagattctatcagattgga |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40688442 |
attagaggcattcataaaggatctaacatattgaatgatgggagcataaggatgagtgtatataggattattccttacactcagattctatcagattgga |
40688343 |
T |
 |
Q |
101 |
gatagtcttgcagttagattcacaaatggcttccttaaaaccgttactccaatatcccaagtgatcaaaaccaaactatgagcaaaattgcatgtaattc |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
40688342 |
gatagtcttgcagttagattcacaaatggcttccttaaaaccgttactccaatatcccaagtgatcagaaccaaactatgagcaaaattgcatgtaattc |
40688243 |
T |
 |
Q |
201 |
cacagcgatattataagtatagtcaataacctaatatt |
238 |
Q |
|
|
||| ||||||||||||||||||||||||||||||||| |
|
|
T |
40688242 |
aacatcgatattataagtatagtcaataacctaatatt |
40688205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University