View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_399 (Length: 249)
Name: NF10145A_low_399
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_399 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 233; Significance: 1e-129; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 6 - 245
Target Start/End: Original strand, 1530978 - 1531218
Alignment:
Q |
6 |
tttggtgttgctgataactatgtggagaaaaatctgattgttatgagattgttgttagttttcacagttatcacttttctcatcattattctcactaa-c |
104 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
1530978 |
tttggtgttgctgataactatgtggagaaaaatctgattgttatgagattgttgttagttttcacagttatcacttttctcatcattattctcactaaac |
1531077 |
T |
 |
Q |
105 |
atcttagaatctccacctcttgatctaggggaatatttccaaatttttatgcttgcatgtatatgtgttttattgatagttatcatatcacctattactg |
204 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1531078 |
atcttagaatctccacctcttgatctaggggaatatttccaaatttttatgcttgcatgtatatgtgttttattgatagttatcatatcacctattactg |
1531177 |
T |
 |
Q |
205 |
ctttaattgtttctatcatttggattattgctctctctcca |
245 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1531178 |
ctttaattgtttctatcatttggattattgctctctctcca |
1531218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 26 - 93
Target Start/End: Original strand, 1526587 - 1526654
Alignment:
Q |
26 |
tgtggagaaaaatctgattgttatgagattgttgttagttttcacagttatcacttttctcatcatta |
93 |
Q |
|
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1526587 |
tgtggagaaaaatctgattgtcatgagattgttgttagttttcacagttatcacttttctcatcatta |
1526654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 21 - 94
Target Start/End: Complemental strand, 23084443 - 23084370
Alignment:
Q |
21 |
aactatgtggagaaaaatctgattgttatgagattgttgttagttttcacagttatcacttttctcatcattat |
94 |
Q |
|
|
|||| ||||||||| ||||| ||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
23084443 |
aactttgtggagaataatctcattgtcatgagattgttattagttttcacagttatcacttttctcatcattat |
23084370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 53 - 110
Target Start/End: Original strand, 1529778 - 1529835
Alignment:
Q |
53 |
attgttgttagttttcacagttatcacttttctcatcattattctcactaacatctta |
110 |
Q |
|
|
|||||||||||||||||| ||||| |||||||||||| |||||||||||| ||||||| |
|
|
T |
1529778 |
attgttgttagttttcactgttattacttttctcatcgttattctcactaccatctta |
1529835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 17 - 71
Target Start/End: Complemental strand, 30217178 - 30217124
Alignment:
Q |
17 |
tgataactatgtggagaaaaatctgattgttatgagattgttgttagttttcaca |
71 |
Q |
|
|
|||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
30217178 |
tgataactttgtggagaaaaatctcattgttatgagattgttgttagttttcaca |
30217124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 17 - 94
Target Start/End: Original strand, 43623782 - 43623859
Alignment:
Q |
17 |
tgataactatgtggagaaaaatctgattgttatgagattgttgttagttttcacagttatcacttttctcatcattat |
94 |
Q |
|
|
|||||||| ||||||||||||||| || ||||||||||||||||||||||||||| | ||| |||||||||| |||| |
|
|
T |
43623782 |
tgataactttgtggagaaaaatctcatcgttatgagattgttgttagttttcacatctttcaattttctcatcgttat |
43623859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 17 - 94
Target Start/End: Complemental strand, 43995224 - 43995147
Alignment:
Q |
17 |
tgataactatgtggagaaaaatctgattgttatgagattgttgttagttttcacagttatcacttttctcatcattat |
94 |
Q |
|
|
|||||||| ||||||||||||||| || ||||||||||||||||||||||||||| | ||| |||||||||| |||| |
|
|
T |
43995224 |
tgataactttgtggagaaaaatctcatcgttatgagattgttgttagttttcacatctttcaattttctcatcgttat |
43995147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University