View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_406 (Length: 249)
Name: NF10145A_low_406
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_406 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 39209379 - 39209612
Alignment:
| Q |
1 |
tgtatatttgaagtttggttaagttgcatgatttcttttgcctttttacccgaaaaaacatgtatcgtcttcaatatgtaactttacttaaaccttcatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39209379 |
tgtatatttgaagtttggttaagttgcatgattacttttgcttttttaccccaaaaaacatgtatcgtcttcaatatgtaactttacttaaaccttcatc |
39209478 |
T |
 |
| Q |
101 |
tgatcttatattatgtaataccacattgaaaagatatttctttctttataatttttcttctcatacttgcctattnnnnnnnttctcaaagggtccttgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39209479 |
tgatcttatattatgtaataccacattgaaaagatatttctttctttataatttttcttctcatacttgcctattaaaaaaattctcaaagggtccttgg |
39209578 |
T |
 |
| Q |
201 |
gaatcttgacaagtaggggatttgttttgatgtc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
39209579 |
gaatcttgacaagtaggggatttgttttgatgtc |
39209612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University