View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_410 (Length: 249)
Name: NF10145A_low_410
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_410 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 24760258 - 24760012
Alignment:
| Q |
1 |
ggaaataaataggttctccatgatactagcaagttcatcgatggattctg----ccgcatagaggtatgagaaagaatggacaaaaaac--gaagtccat |
94 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| || ||||| ||||||||||||||||| |||||||||| ||||| || |
|
|
| T |
24760258 |
ggaaataaatagcttctccatgatactagcaagttcatcgatggattttgtctaccgcagagaggtatgagaaagaagggacaaaaaaaatgaagtacaa |
24760159 |
T |
|
| Q |
95 |
gttttcaaagttctagccaattttattatattacaagcttgttaaatt---atgaaaattgtcatagatgaaagttaatcttttgaacatatgaagcatt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| ||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24760158 |
gttttcaaagttctagccaattttattatataacaagcatgttaaattcttatgaaaattgttatagatgaaagttaatcttttgaacatatgaagcatt |
24760059 |
T |
|
| Q |
192 |
gatataccatacctcacataagaggatatcttcgtctgatgtccatc |
238 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24760058 |
gatataccgtacctcacataagaggatatcttcgtctggtgtccatc |
24760012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University