View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_411 (Length: 249)
Name: NF10145A_low_411
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_411 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 8 - 249
Target Start/End: Original strand, 2346916 - 2347158
Alignment:
Q |
8 |
ttggtgttggtgaggactgtatcagacttggcatctgcatgttttcattctaatgtcaattacataaacagatatgattgtctatttaccggcatgcaga |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2346916 |
ttggtgttggtgaggactgtatcagacttggcatctgcatgttttcattctaatgtcaattacataaacagatatgattgtctatttaccggcatgcaga |
2347015 |
T |
 |
Q |
108 |
tgaacatgaatttactactgtatcagaggccaccaaaaaggtttgcactagctgatcaaaattc-agaaaactactcattattataaatnnnnnnnntgc |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |
|
|
T |
2347016 |
tgaacatgaatttactactgtatcagaggccaccaaaaaggtttgcactagctgatcaaaattcaagaaaactactcattattataaataaaaaaaatgc |
2347115 |
T |
 |
Q |
207 |
gaagaataactaactatcaaaagccataacatccaaaatgcaa |
249 |
Q |
|
|
|||||||||||||||||||| ||||||||||| ||||||||| |
|
|
T |
2347116 |
gaagaataactaactatcaacagccataacataaaaaatgcaa |
2347158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University