View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_413 (Length: 249)
Name: NF10145A_low_413
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_413 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 29 - 231
Target Start/End: Complemental strand, 46006457 - 46006255
Alignment:
| Q |
29 |
aatacagaaatatagaaaattgcaactattccacttgaaaattattcctccaaaattgtagnnnnnnntggtatatgttcgcttggcaatttatattaat |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
46006457 |
aatacagaaatatagaaaattgcaactattccacttgaaaattattcctccaaaattgtagaaaaaaatggtatatgttcgcttcgcaatttatattaat |
46006358 |
T |
 |
| Q |
129 |
ttctcaaaccgtgggtgaattacaattgttctccatactgaatggttaagtcatctacaaagggtggatattcctttttcctaggctttaggatgcctga |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| || || ||||||||||||||||||||||| |
|
|
| T |
46006357 |
ttctcaaaccgtgggtgaattacaattgttctccatactgaatggttaagtcatctactaagagtggatactctttcttcctaggctttaggatgcctga |
46006258 |
T |
 |
| Q |
229 |
tgt |
231 |
Q |
| |
|
||| |
|
|
| T |
46006257 |
tgt |
46006255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University