View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_416 (Length: 249)
Name: NF10145A_low_416
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_416 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 31171108 - 31170887
Alignment:
| Q |
1 |
tcagctgcacaactatcattacttgaagacgaaatgcgccgtatagaaagagtcaatgtaaggccaaagtcataaaagtttatttcttccttttccctcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31171108 |
tcagctgcacaactatcattacttgaagacgaaatgcgccgtatagaaagagtcaatgtaaggccaaagtcataaaagtttatttcttccttttccctcc |
31171009 |
T |
 |
| Q |
101 |
ttaagatctctgttcgtaagataatttcataatgtcgtannnnnnncctttctgctcaatggctactaatttatgacaaacaattttgagcaaatatcac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31171008 |
ttaagatctctgttcgtaagataatttcataatgtcgtattttttccctttctgctcgatggctactaatttatgacaaacaattttgagcaaatatcac |
31170909 |
T |
 |
| Q |
201 |
ttgctttttaacttttcatact |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
31170908 |
ttgctttttaacttttcatact |
31170887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 4 - 65
Target Start/End: Complemental strand, 35224485 - 35224424
Alignment:
| Q |
4 |
gctgcacaactatcattacttgaagacgaaatgcgccgtatagaaagagtcaatgtaaggcc |
65 |
Q |
| |
|
|||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35224485 |
gctgcacagctatcattactcgaagatgaaatgcgccgtatagaaagagtcaatgtaaggcc |
35224424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University