View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_426 (Length: 248)
Name: NF10145A_low_426
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_426 |
 | |
|
| [»] scaffold0057 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 192
Target Start/End: Original strand, 29420848 - 29421035
Alignment:
| Q |
1 |
ggaagaacaagattcgttgttgtgcatgtggattttgtccataatctctgcttcactacgattgagattttttcttctttgaaatttctggcaggtatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29420848 |
ggaagaacaagattcgttgttgtgcatgtggattttgtccataatctctgcttcactacgattgagattttttcttctttgaaatttctggcaggtatgg |
29420947 |
T |
|
| Q |
101 |
gatgaagttcatatctattgctttacacaaatgaaaactcgttcgcgacaacttagatatgaactttgtcaatttccaaaggatctcgcact |
192 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29420948 |
gat----ttcatatctattgctttacacaaatgaaaactcgttcgcgacaacttagatatgaactttgtcaatttccaaaggatctcgcact |
29421035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 149 - 192
Target Start/End: Original strand, 29421043 - 29421086
Alignment:
| Q |
149 |
caacttagatatgaactttgtcaatttccaaaggatctcgcact |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29421043 |
caacttagatatgaactttgtcaatttccaaaagatctcgcact |
29421086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 194 - 233
Target Start/End: Original strand, 29421108 - 29421147
Alignment:
| Q |
194 |
ttgcacaatttactgcacgaatttgtctgaccgctgatgt |
233 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29421108 |
ttgcacaatttactgcacgaatttggctgaccgctgatgt |
29421147 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 89 - 147
Target Start/End: Complemental strand, 25231875 - 25231817
Alignment:
| Q |
89 |
tggcaggtatgggatgaagttcatatctattgctttacacaaatgaaaactcgttcgcg |
147 |
Q |
| |
|
|||||||| ||||| ||| |||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
25231875 |
tggcaggtttgggacgaaattcacacttattgcttcacacaaatgaaaactcgttcgcg |
25231817 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 89 - 147
Target Start/End: Original strand, 13728803 - 13728861
Alignment:
| Q |
89 |
tggcaggtatgggatgaagttcatatctattgctttacacaaatgaaaactcgttcgcg |
147 |
Q |
| |
|
|||||||| ||||| ||| |||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
13728803 |
tggcaggtttgggacgaaattcacacttattgcttcacacaaatgaaaactcgttcgcg |
13728861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 119 - 147
Target Start/End: Complemental strand, 57783 - 57755
Alignment:
| Q |
119 |
tgctttacacaaatgaaaactcgttcgcg |
147 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
57783 |
tgctttacacaaatgaaaactcgttcgcg |
57755 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University