View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_428 (Length: 248)
Name: NF10145A_low_428
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_428 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 15 - 248
Target Start/End: Complemental strand, 11318939 - 11318707
Alignment:
| Q |
15 |
ggacatcatcttgggatgtgatggagttgcctatcaaatgcacatcaactgcagcacttgactctgaaggtgccactacacaagctgcagtagctgaagg |
114 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
11318939 |
ggacatcatcctgggatgtgatggagttgcctatcaaatgcacatcagctgcagcacttggctctgaaggtgccactacacaagctacagtagctgaagg |
11318840 |
T |
 |
| Q |
115 |
tggaaccgtaacttgttgtgtggatatatgagctgctgccaattcggtctcagtatcaacaagggcagtggcaaccggagcttcaatacttggaatattc |
214 |
Q |
| |
|
|| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11318839 |
tg-aaccgtaacttgctgtgtggatatatgagctgctgccaattcggtctcagtatcaacaagggcagtggcaaccggagcttcaatacttggaatattc |
11318741 |
T |
 |
| Q |
215 |
gagggaataacttgagttggggaaacattatcat |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
11318740 |
gagggaataacttgagttggggaaacattatcat |
11318707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University