View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_430 (Length: 248)
Name: NF10145A_low_430
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_430 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 31328025 - 31327787
Alignment:
| Q |
1 |
gtattcatcttggcttgttattttgtcatagaggttttgttagcatagtaataggctcggtttggataaacaatttaactaagtgttaatagcataatct |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31328025 |
gtattcatcttggcttgttattatgtcatagaggtta-gttagcatagtaataggctcagtttggataaacaatttaactaagtgttaatagcataatct |
31327927 |
T |
|
| Q |
101 |
ctgttacaccaacacttctgattgaatgtgtgtttcagtgtccgacgctgac-----acgacacttgtgattgcattaaattacgtcannnnnnnaaaa- |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||||||||||||||||| || | |||| |
|
|
| T |
31327926 |
ctgttacaccaacacttctgattgaatgtgtgttccactgtccgacgctgacacgatacgacacttgtgattgcattaaattatgtaattttcttaaaat |
31327827 |
T |
|
| Q |
195 |
ttttatcggtgttgacgtgtcagtattgtgtctgatgtcc |
234 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
31327826 |
ttttattgatgttgacgtgtcagtattgtgtctgatgtcc |
31327787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 13484127 - 13484072
Alignment:
| Q |
99 |
ctctgttacaccaacacttctgattgaatgtgtgtttcagtgtccgacgctgacac |
154 |
Q |
| |
|
||||||| |||||||||||||||||||||| |||| ||||||||||| ||||||| |
|
|
| T |
13484127 |
ctctgttgcaccaacacttctgattgaatgcatgttccagtgtccgacactgacac |
13484072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 60 - 102
Target Start/End: Complemental strand, 17125818 - 17125776
Alignment:
| Q |
60 |
gtttggataaacaatttaactaagtgttaatagcataatctct |
102 |
Q |
| |
|
||||||||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
17125818 |
gtttggataaacaattttattaagtgctaatagcataatctct |
17125776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 99
Target Start/End: Complemental strand, 8423030 - 8422986
Alignment:
| Q |
55 |
gctcggtttggataaacaatttaactaagtgttaatagcataatc |
99 |
Q |
| |
|
|||| |||||||||||||| |||| |||||||| ||||||||||| |
|
|
| T |
8423030 |
gctcagtttggataaacaacttaattaagtgtttatagcataatc |
8422986 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 138 - 215
Target Start/End: Original strand, 26915230 - 26915307
Alignment:
| Q |
138 |
gtgtccgacgctgacacgacacttgtgattgcattaaattacgtcannnnnnnaaaattttatcggtgttgacgtgtc |
215 |
Q |
| |
|
||||||||| | |||||||||||||||||| |||||||||| |||| ||||||||||| |||| |||||||| |
|
|
| T |
26915230 |
gtgtccgacaccgacacgacacttgtgattacattaaattatgtcattttctcaaaattttatccgtgtcgacgtgtc |
26915307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University