View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_434 (Length: 248)
Name: NF10145A_low_434
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_434 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 4 - 248
Target Start/End: Complemental strand, 53993542 - 53993298
Alignment:
| Q |
4 |
tggagttccgcaatcattttgttggcgttgacaatgattgttgttgatcttatggtatttttcttcatttcaactagcactagannnnnnnaattgtgga |
103 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53993542 |
tggagttccgcaatcattttgttggtgttgacaatgattgttgttgatcttatggtatttttcttcatttcaactagcactagatttttttaattgtgga |
53993443 |
T |
|
| Q |
104 |
ttgaaatgtgtattatgtagttctttttactgtttcatatttttattggtgcttgatatttggaatttcaaatcaccatgttaatttgtttacttacaat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53993442 |
ttgaaatgtgtattatgtagttctttttactgtttcatgtttttattggtgcttgatatttagaatttcaaatcaccatgttaatttgtttacttacaat |
53993343 |
T |
|
| Q |
204 |
attatgctttgtagggtatgatggccattctgaatatccaattga |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53993342 |
attatgctttgtagggtatgatggccattctgaatatccaattga |
53993298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 137 - 207
Target Start/End: Original strand, 35984507 - 35984577
Alignment:
| Q |
137 |
ttcatatttttattggtgcttgatatttggaatttcaaatcaccatgttaatttgtttacttacaatatta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||| ||||||||||||||||| ||| | |||||||||| |
|
|
| T |
35984507 |
ttcatatttttattggtgcttgatatttagaaattctaatcaccatgttaatttcttttcatacaatatta |
35984577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University