View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_435 (Length: 248)
Name: NF10145A_low_435
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_435 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 173
Target Start/End: Complemental strand, 40160715 - 40160543
Alignment:
| Q |
1 |
tcagatgttttatgtgatactaaaatatcatgttgaaggaaatattttatcaaataacaataagaccaaccaacacgagaatatgcgacctggatcgtct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
40160715 |
tcagatgttttatgtgatactaaaatatcatgctgaagggaatattttatcgaataacaataagaccaaccaacacgagaatatgcgacctggatcgcct |
40160616 |
T |
 |
| Q |
101 |
gttgtaactgttccacacagttttacgcagtacacaatctcagccacttaaatacgatctaacagttcatatt |
173 |
Q |
| |
|
| |||||||| |||||||||||||||||| |||| |||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40160615 |
gctgtaactgctccacacagttttacgcattacataatctcagccacttaaatacgatctaacggttcatatt |
40160543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 172 - 241
Target Start/End: Complemental strand, 40162193 - 40162124
Alignment:
| Q |
172 |
tttattttgaagtatatctaataattttttaagaagcatgaatattttcaaatggtattaatattattcg |
241 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40162193 |
tttattttgaacgatatctaataattttttaagaagcatgaatattttcaaatggtattaatatttttcg |
40162124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 103 - 176
Target Start/End: Complemental strand, 12266095 - 12266020
Alignment:
| Q |
103 |
tgtaactgttccacacagttttacgcagtacacaatctcagccacttaaatacg--atctaacagttcatatttat |
176 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||||| ||| |||| || ||||||||||||| |||||| |
|
|
| T |
12266095 |
tgtaactgttccacgtagtttcacgcagtacacaatctcagtcacaaaaatgcgatatctaacagttcagatttat |
12266020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University