View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_436 (Length: 248)
Name: NF10145A_low_436
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_436 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 163 - 235
Target Start/End: Original strand, 6703330 - 6703402
Alignment:
| Q |
163 |
gttattcatcattatagtcgattttctaggacattttatcaagaatattatggtagagtacctagtgttatat |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6703330 |
gttattcatcattatagtcgattttctaggacattttatcaagaatattatgatagagtacctagtgttatat |
6703402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 12 - 51
Target Start/End: Original strand, 6703178 - 6703217
Alignment:
| Q |
12 |
atggacatcagaatttgtgtttatgccattgatcatatta |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6703178 |
atggacatcagaatttgtgtttatgccattgatcatatta |
6703217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University