View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_437 (Length: 248)
Name: NF10145A_low_437
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_437 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 3 - 243
Target Start/End: Original strand, 10566814 - 10567054
Alignment:
| Q |
3 |
tctacagaatgactagtatttgaatccttatccatagcatcagtggacatctctacaaattttctttggtccttttgccaagaggatgttactgagggtc |
102 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10566814 |
tctacagaatgtctattatttgaatccttatccatagcatcagtggacatcactacaaatttactttggtccttttgccaagaggatgttactgagggtc |
10566913 |
T |
 |
| Q |
103 |
cagaacaactatataactcagagatagcactatattgactttcaaactcaccacggtctggaatagatctaatcgtcttcatgaactctaaataatcagt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10566914 |
cagaacaactatataactcagagatagcactatattgactttcaaactcaccacggtctggaatagatctaatcgtcttcatgaactctaaataatcagt |
10567013 |
T |
 |
| Q |
203 |
ccccatacatggaacctccgagttgatgtccatctcattga |
243 |
Q |
| |
|
||||||||||||||||||||||||| | ||| ||||||||| |
|
|
| T |
10567014 |
ccccatacatggaacctccgagttgttttccttctcattga |
10567054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University