View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_439 (Length: 247)
Name: NF10145A_low_439
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_439 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 13 - 247
Target Start/End: Complemental strand, 3592424 - 3592186
Alignment:
| Q |
13 |
agatggacatcatgacattagtatccataaacttttggataactgttgcttagattgtttg----atcttcttgatcttgaacaatgcagattgacagtg |
108 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3592424 |
agatggccatcatgacattagtatccataaacttttggataactgttgcttagattgtttggtcgatcttcttgatcttgaacaatgcagattgacagtg |
3592325 |
T |
 |
| Q |
109 |
ttcatgaagatggtgcagtggtttttaaagatggaaatgcagttattgctgacttcattgtacattgcacagggtattcttagcattccctattagtttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3592324 |
ttcatgaagatggtgcagtggtttttaaagatggaaatgcagttatcgctgacttcattgtacattgcacagggtattcttagcattccctattagtttt |
3592225 |
T |
 |
| Q |
209 |
tcttttaaaccagtttatattgtggacttaagttttaaa |
247 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3592224 |
tcttttaaaccagttcatattgtggacttaagttttaaa |
3592186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University