View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_442 (Length: 247)
Name: NF10145A_low_442
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_442 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 21 - 232
Target Start/End: Complemental strand, 54176653 - 54176442
Alignment:
| Q |
21 |
catttccaacaacattaatgatgtcataggcaggacgaaaaagagatctttctgaatcaagttttattggacctgataatccaacaaaattactccgcaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54176653 |
catttccaacaacattaatgatgtcataggcaggacgaaaaagagatctttctgaatcaagttttattggacctgataatccaacaaaattactccgcaa |
54176554 |
T |
|
| Q |
121 |
tatattgttcaacagaagagttccattgtcaaatatgctcattgcatcaaggttaagaccaccagctttatcactatgcaaacttgtgtaattggtacat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54176553 |
tatattgttcaacagaagagttccattgtcaaatatgctcattgcatcaaggttaagaccaccagctttatcactatgcaaacttgtgtaattggtacat |
54176454 |
T |
|
| Q |
221 |
gacacaacacca |
232 |
Q |
| |
|
|||||||||||| |
|
|
| T |
54176453 |
gacacaacacca |
54176442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University