View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_447 (Length: 247)
Name: NF10145A_low_447
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_447 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 227
Target Start/End: Complemental strand, 34572254 - 34572046
Alignment:
| Q |
19 |
caagggacaacaaatttgcaagaaggggcttggtcctggaaagatgaagatatgtcttgtttgactcgagtcgtcaactatacaaaagctgcttcaaaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34572254 |
caagggacaacaaatttgcaagaaggggcttggtcctggaaagatgaagatatgtcttgtttgactcgagtcgtcaactatacaaaagctgcttcaaaat |
34572155 |
T |
|
| Q |
119 |
tggttaaagctctcaataccaccgaggaacaaacctatattagagcgactaaagatgaatttgatgtacttgttagtgtatgcacccctgaggttcctta |
218 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34572154 |
tggttaaagctctcaataccactgaggaacaaacctatattagagcgactaaagatgaatttgatgtacttgttagtgtatgcacccctgaggttcctta |
34572055 |
T |
|
| Q |
219 |
tgggcattc |
227 |
Q |
| |
|
|||| |||| |
|
|
| T |
34572054 |
tgggaattc |
34572046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University