View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_450 (Length: 247)
Name: NF10145A_low_450
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_450 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 3469690 - 3469448
Alignment:
| Q |
1 |
gacatctaagccactactgagatacaaaagggaatatgcaatttgtccttggttttacattggtagtaaaatagttggtggctcaaaaacactaagagga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3469690 |
gacatctaagccactactgagatacaaaatggaatatgcaatttgtccttgattttacattggtaataaaatagttggtggctcaaaaacactaagagga |
3469591 |
T |
|
| Q |
101 |
ttgtttggcatcaaacaaacaggtaaacctggtccatagaactctactcaacattcacagcctgtggatctctgttgtcgtccaccattgccgacatcga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3469590 |
ttgtttggcatcaaacaaacaggtaaacctggtccatagaactctactcaacattcacagcctgtggatctctgttgtcgtccaccattgccgacatcga |
3469491 |
T |
|
| Q |
201 |
ttgtatcgggcagatacctggtataatcaacaaacaccatact |
243 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3469490 |
ttgtatcgggcagatacctggtatagtcaacaaacaccatact |
3469448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 186
Target Start/End: Original strand, 39873140 - 39873188
Alignment:
| Q |
138 |
agaactctactcaacattcacagcctgtggatctctgttgtcgtccacc |
186 |
Q |
| |
|
|||||||| |||||||||||||||||| || |||||||| |||||||| |
|
|
| T |
39873140 |
agaactcttatcaacattcacagcctgttgacctctgttgccgtccacc |
39873188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University