View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_452 (Length: 247)
Name: NF10145A_low_452
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_452 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 17 - 114
Target Start/End: Complemental strand, 5930290 - 5930193
Alignment:
| Q |
17 |
aaaaatggcagggcaaaaagtaaatcttaacaagaggtggtaaaatctaaaacaacttcctgataagtatgatctctttaatgttcttggtaacaatt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
5930290 |
aaaaatggcagggcaaaaagtaaatcttaacaagaggtggtaaaatctaaaacaacttcctgataagtatgatctgtttaatgttcctggtaacaatt |
5930193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 118 - 247
Target Start/End: Complemental strand, 5928928 - 5928801
Alignment:
| Q |
118 |
aatgagatttggctactgtcaatcatgagattacnnnnnnngatagcttcatgatattagcacttcaatttttcaatgttccaaatatgtatgatcagaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
5928928 |
aatgagatttggctactgtcaatcatgacattacaaaaac--atagcttcatgatattagcacttctatttttcaatgttccaaatatgtatgatcaaaa |
5928831 |
T |
 |
| Q |
218 |
caataattcctaacacaattctatatcaat |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5928830 |
caataattcctaacacaattctatatcaat |
5928801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University