View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_453 (Length: 247)
Name: NF10145A_low_453
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_453 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 46366808 - 46367037
Alignment:
| Q |
1 |
gcaagcacatctcgtgatagcttacttgcagcagttcatgatgcgttgcaaactgatgtaggtattcttggttatgaattgttctatgattgtacgtgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
46366808 |
gcaagcacatctcgtgatagcttacttgcagcagttcatgatgcgttgcaaactgatgtaggtattcttggttatgaattgttctatgattgtatgtgtc |
46366907 |
T |
|
| Q |
101 |
cattgaataacggtgatgtgtgtcttacgatagttgttttatctgtttatttccgaactgaaggaaattatgtttaatagtactgatattaacagaaagc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46366908 |
cattgaataacggtgatgtgtgtcttacgatagttgttttatctggttatttccgaactgaaggaaattatgtttaatagtactgatattaatagaaagc |
46367007 |
T |
|
| Q |
201 |
gtcaagtgcgtgtttgatttatggtgatgt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
46367008 |
gtcaagtgcgtgtttgatttatggtgatgt |
46367037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University