View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_457 (Length: 246)
Name: NF10145A_low_457
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_457 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 19 - 224
Target Start/End: Original strand, 44189354 - 44189559
Alignment:
Q |
19 |
acatcagccgaccatagacaacaaagaaacagtaaactttatgagagcgaaaacattgtgtgattaaaaatcaaaattcattatatctttagggaggaaa |
118 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
44189354 |
acataagccgaccatagacaacaaagaaacagtaaactttatgagagcgaaaacattgtgtgattaaaaatcaaaattcattatatctttagggaggaaa |
44189453 |
T |
 |
Q |
119 |
ttcacaattgtaaaagtgttttttaaggctacatattacatgcacctttcacttgtctgcgctttcccagcgagtgagggtcaataaacatgttagggag |
218 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |||||||||| |
|
|
T |
44189454 |
ttcacaattgtaaaagtgttttttaaggctacatattacatgcacctttcacttgtctgcgctttcccaacgagtgagggtcgataaacgtgttagggag |
44189553 |
T |
 |
Q |
219 |
tatcat |
224 |
Q |
|
|
|||||| |
|
|
T |
44189554 |
tatcat |
44189559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University