View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_46 (Length: 423)
Name: NF10145A_low_46
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 67 - 245
Target Start/End: Original strand, 4119639 - 4119818
Alignment:
Q |
67 |
aataaaacttcatata--ttttttattgaattaattcttatcaagagatatatatgaaacatcacaggcgaacgaggaaaaggcgtttgacgattcatga |
164 |
Q |
|
|
|||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
4119639 |
aataaaacttcatatacattttttattgaattagttcttatcaagagatat--atgaaacatcacaggcgaacgaggaaaaggcatttgacgattcatga |
4119736 |
T |
 |
Q |
165 |
caactctgtcgtgacattttagaagattccgatacggtggtcagagaattcagtttccttg-agtctgagatatgttaactg |
245 |
Q |
|
|
||||||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||| || ||||||||||| ||||| |
|
|
T |
4119737 |
caactctgtcgtgacattttagaagattctgatacagtggtcagggaattcagtttccttgaagcctgagatatgtcaactg |
4119818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 1 - 68
Target Start/End: Original strand, 4119341 - 4119408
Alignment:
Q |
1 |
atgaactttgtggtgacgtttcatgagatatgatgaattgggaacatactgatcatcatagtctagaa |
68 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
4119341 |
atgaactttgtggtgacgtttcaggagatatgatgaattgggaacatgctgatcatcatagtctagaa |
4119408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University