View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_466 (Length: 245)
Name: NF10145A_low_466
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_466 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 13 - 243
Target Start/End: Original strand, 3591978 - 3592208
Alignment:
Q |
13 |
atggacatcaacattggttcacttttttcttttagttaatatgcaagactttatgtctcaattgcaggttacttatgcctaaatatatttgagtcctcaa |
112 |
Q |
|
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3591978 |
atggacatcaacattggttcacttttttcttgtagttaatatgcaagactttatgtctcaattgcaggttacttatgcctaaatatatttgagtcctcaa |
3592077 |
T |
 |
Q |
113 |
catggttttaaattgcagttgtgcctgtcgttgctataactttgcaattttgacattgtcgataaatgcggttcctccaaaacatttgtattgcagccgc |
212 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3592078 |
catggttttaaattgcagttgtgcctgtcgttgctataactttgcaattttgacattgtcgataaatgcggttcctccaaaacatttgtattgcagccgc |
3592177 |
T |
 |
Q |
213 |
atttacgatttaaaacttaagtccacaatat |
243 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
3592178 |
atttacgatttaaaacttaagtccacaatat |
3592208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University