View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_469 (Length: 245)
Name: NF10145A_low_469
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_469 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 15 - 245
Target Start/End: Original strand, 29420382 - 29420612
Alignment:
| Q |
15 |
catcatgatgaaaatggttcctatcttgggaaaagaacgtaacaattcccacatcataatattttttgttgaaggtggggcagctgaagattaatgattt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29420382 |
catcatgatgaaaatggttcctatcttgggaaaagaacgtaacaattcccacatcataatattttttgttgaaggtggggcagctgaagattaatgattt |
29420481 |
T |
|
| Q |
115 |
gttccattgcttgttgtagaaatgtatataacaaagtaaattagtttcagctcttctgtaaagagggnnnnnnngtttcaatgccttgacctagaaatac |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
29420482 |
gttccattgcttgttgtagaaatgtatataacaaagtaaattagtttcagctcttctgtaaagagggaaaaaaagtttcaatgccttgacctagaagtac |
29420581 |
T |
|
| Q |
215 |
ttgtaacaccaccacatataagacaaggaaa |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
29420582 |
ttgtaacaccaccacatataagacaaggaaa |
29420612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University