View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_470 (Length: 245)
Name: NF10145A_low_470
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_470 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 124 - 230
Target Start/End: Original strand, 22054918 - 22055024
Alignment:
| Q |
124 |
ttagacttcgggttgaacatactagttgtaggtaattgaattagccttctaaggatacagtaatcaaattaattgcatatttaactcaaaatatgatctg |
223 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22054918 |
ttagacttcgggctgaacatactagttgtaggtaattgaattagccttctaaggatacagtaatcaaattaattgcatatttaactcaaaatatgatctg |
22055017 |
T |
|
| Q |
224 |
aacacca |
230 |
Q |
| |
|
||||||| |
|
|
| T |
22055018 |
aacacca |
22055024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University