View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_473 (Length: 245)
Name: NF10145A_low_473
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10145A_low_473 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 38 - 226
Target Start/End: Complemental strand, 42849703 - 42849515
Alignment:
| Q |
38 |
gttgaaaaaactgggggattctaagtccattgaagaatgcaaattgatgattaaaagatttgatttggatggtgatggtgtgcttagttttgaagaattc |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42849703 |
gttgaaaaaactgggggattctaagtccattgaagaatgcaaattgatgattaaaagatttgatttggatggtgatggtgtgcttagttttgaagaattc |
42849604 |
T |
 |
| Q |
138 |
agaatcatgatggattgagtgtgatgatatgtttatgattatatatatcatgcgttttggccagaggctgcggggttaatttcattcat |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42849603 |
agaatcatgatggattgagtgtgatgatatgtttatgattatatatatcatgtgttttggccagaggctgcggggttaatttcattcat |
42849515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 38 - 155
Target Start/End: Complemental strand, 42846716 - 42846599
Alignment:
| Q |
38 |
gttgaaaaaactgggggattctaagtccattgaagaatgcaaattgatgattaaaagatttgatttggatggtgatggtgtgcttagttttgaagaattc |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42846716 |
gttgaaaaaactgggggattctaagtccattgaagaatgcaaattgatgattaaaagatttgatttggatggtgatggtgtgcttagttttgaagaattc |
42846617 |
T |
 |
| Q |
138 |
agaatcatgatggattga |
155 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
42846616 |
agaatcatgatggattga |
42846599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 38 - 151
Target Start/End: Complemental strand, 42839908 - 42839795
Alignment:
| Q |
38 |
gttgaaaaaactgggggattctaagtccattgaagaatgcaaattgatgattaaaagatttgatttggatggtgatggtgtgcttagttttgaagaattc |
137 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
42839908 |
gttgaaaaagttgggggattctaagtccattgaagaatgtaaagtgatgattaaaagatttgatttggatggtgatggtgtgcttagttttgaagagttc |
42839809 |
T |
 |
| Q |
138 |
agaatcatgatgga |
151 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
42839808 |
agaatcatgatgga |
42839795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 138
Target Start/End: Complemental strand, 33931471 - 33931390
Alignment:
| Q |
57 |
tctaagtccattgaagaatgcaaattgatgattaaaagatttgatttggatggtgatggtgtgcttagttttgaagaattca |
138 |
Q |
| |
|
|||||||| ||||| ||||| ||| ||||||||| |||||||||||||| |||||| ||||||| ||||| ||||||| |
|
|
| T |
33931471 |
tctaagtctattgatgaatgtaaagctatgattaaacattttgatttggatggggatggtttgcttagctttgatgaattca |
33931390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 138
Target Start/End: Complemental strand, 33938276 - 33938195
Alignment:
| Q |
57 |
tctaagtccattgaagaatgcaaattgatgattaaaagatttgatttggatggtgatggtgtgcttagttttgaagaattca |
138 |
Q |
| |
|
|||||||| ||||| ||||| ||| ||||||||| |||||||||||||| |||||| ||||||| ||||| ||||||| |
|
|
| T |
33938276 |
tctaagtctattgatgaatgtaaagctatgattaaacattttgatttggatggggatggtttgcttagctttgatgaattca |
33938195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University