View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_476 (Length: 244)
Name: NF10145A_low_476
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_476 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 22 - 232
Target Start/End: Complemental strand, 38224922 - 38224712
Alignment:
Q |
22 |
actaatagcaattgaaaaataatggatgctgaacacctcagaaattgtgtcagatcccactttcggtttagtggtgggtcctccctcaaatttatacaca |
121 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38224922 |
actaatcgcaattgaaaaataatggatgctgaacacctcagaaattgtgtcagatcccactttcggtttagtggtgggtcctccctcaaatttatacaca |
38224823 |
T |
 |
Q |
122 |
cgtatataactataaatagaattttgctagccagaacaaattcatacttcagaggtgtaacaatttaccatattctaaggtccaggtattgtttccttta |
221 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
38224822 |
cgtatataactataaatagaattttgctagccagaacaaattcatacttcagaggtggaacaatttaccatagtctaaggtccaggtattgtttccttta |
38224723 |
T |
 |
Q |
222 |
gtcttgatatt |
232 |
Q |
|
|
||||||||||| |
|
|
T |
38224722 |
gtcttgatatt |
38224712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University