View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_482 (Length: 244)
Name: NF10145A_low_482
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_482 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 21 - 222
Target Start/End: Complemental strand, 26933652 - 26933450
Alignment:
Q |
21 |
catagtgggtccattatttttgggtcgagacaacacaagttttgagatgttatttccaacagcaagcataatgatactttcaacatttgcagaatttgga |
120 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26933652 |
catagtgggtccattatttttgggtcgagacaacacaagttttgagatgttatttccaacagcaagcataatgatactttcaacatttgcagaatttgga |
26933553 |
T |
 |
Q |
121 |
atgataatttatttctttaaggt-ggggtgcaaataaactctaaacagatttttatggttgagaagcgtgcagtaataattggaatattaggccacttat |
219 |
Q |
|
|
||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
26933552 |
atgataatttatttctttaagatgggggtgcaaataaactctaaacagatttttatggttgagaagcgtgcagtaataattggaatatcaggccacttat |
26933453 |
T |
 |
Q |
220 |
ctt |
222 |
Q |
|
|
||| |
|
|
T |
26933452 |
ctt |
26933450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University