View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10145A_low_483 (Length: 244)
Name: NF10145A_low_483
Description: NF10145A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF10145A_low_483 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 6 - 86
Target Start/End: Complemental strand, 50422866 - 50422786
Alignment:
Q |
6 |
gtttggtgttcgaacaaaattttatgatctagcgannnnnnnataagctaaaaataagcatatatagaagagactaatggt |
86 |
Q |
|
|
|||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50422866 |
gttttgtgttcgaacaaaattttatgatctagcgatttttttataagctaaaaataagcatatatagaagagactaatggt |
50422786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University